1 Introduction

The ensembldb package provides functions to create and use transcript centric annotation databases/packages. The annotation for the databases are directly fetched from Ensembl 1 using their Perl API. The functionality and data is similar to that of the TxDb packages from the GenomicFeatures package, but, in addition to retrieve all gene/transcript models and annotations from the database, the ensembldb package provides also a filter framework allowing to retrieve annotations for specific entries like genes encoded on a chromosome region or transcript models of lincRNA genes. From version 1.7 on, EnsDb databases created by the ensembldb package contain also protein annotation data (see Section 11 for the database layout and an overview of available attributes/columns). For more information on the use of the protein annotations refer to the proteins vignette.

Another main goal of this package is to generate versioned annotation packages, i.e. annotation packages that are build for a specific Ensembl release, and are also named according to that (e.g. EnsDb.Hsapiens.v75 for human gene definitions of the Ensembl code database version 75). This ensures reproducibility, as it allows to load annotations from a specific Ensembl release also if newer versions of annotation packages/releases are available. It also allows to load multiple annotation packages at the same time in order to e.g. compare gene models between Ensembl releases.

In the example below we load an Ensembl based annotation package for Homo sapiens, Ensembl version 75. The EnsDb object providing access to the underlying SQLite database is bound to the variable name EnsDb.Hsapiens.v75.

library(EnsDb.Hsapiens.v75)

## Making a "short cut"
edb <- EnsDb.Hsapiens.v75
## print some informations for this package
edb
## EnsDb for Ensembl:
## |Backend: SQLite
## |Db type: EnsDb
## |Type of Gene ID: Ensembl Gene ID
## |Supporting package: ensembldb
## |Db created by: ensembldb package from Bioconductor
## |script_version: 0.2.3
## |Creation time: Tue Nov 15 23:35:19 2016
## |ensembl_version: 75
## |ensembl_host: localhost
## |Organism: homo_sapiens
## |genome_build: GRCh37
## |DBSCHEMAVERSION: 1.0
## | No. of genes: 64102.
## | No. of transcripts: 215647.
## |Protein data available.
## For what organism was the database generated?
organism(edb)
## [1] "Homo sapiens"

2 Using ensembldb annotation packages to retrieve specific annotations

One of the strengths of the ensembldb package and the related EnsDb databases is its implementation of a filter framework that enables to efficiently extract data sub-sets from the databases. The ensembldb package supports most of the filters defined in the AnnotationFilter Bioconductor package and defines some additional filters specific to the data stored in EnsDb databases. The supportedFilters method can be used to get an overview over all supported filter classes, each of them (except the GRangesFilter) working on a single column/field in the database.

supportedFilters(edb)
##  [1] "EntrezFilter"             "ExonEndFilter"           
##  [3] "ExonIdFilter"             "ExonRankFilter"          
##  [5] "ExonStartFilter"          "GRangesFilter"           
##  [7] "GeneBiotypeFilter"        "GeneEndFilter"           
##  [9] "GeneIdFilter"             "GeneStartFilter"         
## [11] "GenenameFilter"           "ProtDomIdFilter"         
## [13] "ProteinIdFilter"          "SeqNameFilter"           
## [15] "SeqStrandFilter"          "SymbolFilter"            
## [17] "TxBiotypeFilter"          "TxEndFilter"             
## [19] "TxIdFilter"               "TxNameFilter"            
## [21] "TxStartFilter"            "UniprotDbFilter"         
## [23] "UniprotFilter"            "UniprotMappingTypeFilter"

These filters can be divided into 3 main filter types:

  • IntegerFilter: filter classes extending this basic object can take a single numeric value as input and support the conditions =, !, >, <, >= and <=. All filters that work on chromosomal coordinates, such as the GeneEndFilter extend IntegerFilter.
  • CharacterFilter: filter classes extending this object can take a single or multiple character values as input and allow conditions: =, !, “startsWith” and “endsWith”. All filters working on IDs extend this class.
  • GRangesFilter: takes a GRanges object as input and supports all conditions that findOverlaps from the IRanges package supports (“any”, “start”, “end”, “within”, “equal”). Note that these have to be passed using the parameter type to the constructor function.

The supported filters are:

  • EntrezFilter: allows to filter results based on NCBI Entrezgene identifiers of the genes.
  • ExonEndFilter: filter using the chromosomal end coordinate of exons.
  • ExonIdFilter: filter based on the (Ensembl) exon identifiers.
  • ExonRankFilter: filter based on the rank (index) of an exon within the transcript model. Exons are always numbered from 5’ to 3’ end of the transcript, thus, also on the reverse strand, the exon 1 is the most 5’ exon of the transcript.
  • ExonStartFilter: filter using the chromosomal start coordinate of exons.
  • GeneBiotypeFilter: filter using the gene biotypes defined in the Ensembl database; use the listGenebiotypes method to list all available biotypes.
  • GeneEndFilter: filter using the chromosomal end coordinate of gene.
  • GeneIdFilter: filter based on the Ensembl gene IDs.
  • GenenameFilter: filter based on the names (symbols) of the genes.
  • GeneStartFilter: filter using the chromosomal start coordinate of gene.
  • GRangesFilter: allows to retrieve all features (genes, transcripts or exons) that are either within (setting parameter type to “within”) or partially overlapping (setting type to “any”) the defined genomic region/range. Note that, depending on the called method (genes, transcripts or exons) the start and end coordinates of either the genes, transcripts or exons are used for the filter. For methods exonsBy, cdsBy and txBy the coordinates of by are used.
  • SeqNameFilter: filter by the name of the chromosomes the genes are encoded on.
  • SeqStrandFilter: filter for the chromosome strand on which the genes are encoded.
  • SymbolFilter: filter on gene symbols; note that no database columns symbol is available in an EnsDb database and hence the gene name is used for filtering.
  • TxBiotypeFilter: filter on the transcript biotype defined in Ensembl; use the listTxbiotypes method to list all available biotypes.
  • TxEndFilter: filter using the chromosomal end coordinate of transcripts.
  • TxIdFilter: filter on the Ensembl transcript identifiers.
  • TxNameFilter: filter on the Ensembl transcript names (currently identical to the transcript IDs).
  • TxStartFilter: filter using the chromosomal start coordinate of transcripts.

In addition to the above listed DNA-RNA-based filters, protein-specific filters are also available:

  • ProtDomIdFilter: filter by the protein domain ID.
  • ProteinIdFilter: filter by Ensembl protein ID filters.
  • UniprotDbFilter: filter by the name of the Uniprot database.
  • UniprotFilter: filter by the Uniprot ID.
  • UniprotMappingTypeFilter: filter by the mapping type of Ensembl protein IDs to Uniprot IDs.

These can however only be used on EnsDb databases that provide protein annotations, i.e. for which a call to hasProteinData returns TRUE.

A simple use case for the filter framework would be to get all transcripts for the gene BCL2L11. To this end we specify a GenenameFilter with the value BCL2L11. As a result we get a GRanges object with start, end, strand and seqname being the start coordinate, end coordinate, chromosome name and strand for the respective transcripts. All additional annotations are available as metadata columns. Alternatively, by setting return.type to “DataFrame”, or “data.frame” the method would return a DataFrame or data.frame object instead of the default GRanges.

Tx <- transcripts(edb, filter = list(GenenameFilter("BCL2L11")))

Tx
## GRanges object with 17 ranges and 7 metadata columns:
##                   seqnames                 ranges strand |           tx_id
##                      <Rle>              <IRanges>  <Rle> |     <character>
##   ENST00000432179        2 [111876955, 111881689]      + | ENST00000432179
##   ENST00000308659        2 [111878491, 111922625]      + | ENST00000308659
##   ENST00000357757        2 [111878491, 111919016]      + | ENST00000357757
##   ENST00000393253        2 [111878491, 111909428]      + | ENST00000393253
##   ENST00000337565        2 [111878491, 111886423]      + | ENST00000337565
##               ...      ...                    ...    ... .             ...
##   ENST00000452231        2 [111881323, 111921808]      + | ENST00000452231
##   ENST00000361493        2 [111881323, 111921808]      + | ENST00000361493
##   ENST00000431217        2 [111881323, 111921929]      + | ENST00000431217
##   ENST00000439718        2 [111881323, 111922220]      + | ENST00000439718
##   ENST00000438054        2 [111881329, 111903861]      + | ENST00000438054
##                                tx_biotype tx_cds_seq_start tx_cds_seq_end
##                               <character>        <integer>      <integer>
##   ENST00000432179          protein_coding        111881323      111881689
##   ENST00000308659          protein_coding        111881323      111921808
##   ENST00000357757          protein_coding        111881323      111919016
##   ENST00000393253          protein_coding        111881323      111909428
##   ENST00000337565          protein_coding        111881323      111886328
##               ...                     ...              ...            ...
##   ENST00000452231 nonsense_mediated_decay        111881323      111919016
##   ENST00000361493 nonsense_mediated_decay        111881323      111887812
##   ENST00000431217 nonsense_mediated_decay        111881323      111902078
##   ENST00000439718 nonsense_mediated_decay        111881323      111909428
##   ENST00000438054          protein_coding        111881329      111902068
##                           gene_id         tx_name   gene_name
##                       <character>     <character> <character>
##   ENST00000432179 ENSG00000153094 ENST00000432179     BCL2L11
##   ENST00000308659 ENSG00000153094 ENST00000308659     BCL2L11
##   ENST00000357757 ENSG00000153094 ENST00000357757     BCL2L11
##   ENST00000393253 ENSG00000153094 ENST00000393253     BCL2L11
##   ENST00000337565 ENSG00000153094 ENST00000337565     BCL2L11
##               ...             ...             ...         ...
##   ENST00000452231 ENSG00000153094 ENST00000452231     BCL2L11
##   ENST00000361493 ENSG00000153094 ENST00000361493     BCL2L11
##   ENST00000431217 ENSG00000153094 ENST00000431217     BCL2L11
##   ENST00000439718 ENSG00000153094 ENST00000439718     BCL2L11
##   ENST00000438054 ENSG00000153094 ENST00000438054     BCL2L11
##   -------
##   seqinfo: 1 sequence from GRCh37 genome
## as this is a GRanges object we can access e.g. the start coordinates with
head(start(Tx))
## [1] 111876955 111878491 111878491 111878491 111878491 111878506
## or extract the biotype with
head(Tx$tx_biotype)
## [1] "protein_coding" "protein_coding" "protein_coding" "protein_coding"
## [5] "protein_coding" "protein_coding"

The parameter columns of the extractor methods (such as exons, genes or transcripts) allows to specify which database attributes (columns) should be retrieved. The exons method returns by default all exon-related columns, the transcripts all columns from the transcript database table and the genes all from the gene table. Note however that in the example above we got also a column gene_name although this column is not present in the transcript database table. By default the methods return also all columns that are used by any of the filters submitted with the filter argument (thus, because a GenenameFilter was used, the column gene_name is also returned). Setting returnFilterColumns(edb) <- FALSE disables this option and only the columns specified by the columns parameter are retrieved.

Instead of passing a filter object to the method it is also possible to provide a filter expression written as a formula.

## Use a filter expression to perform the filtering.
transcripts(edb, filter = ~ genename == "ZBTB16")
## GRanges object with 9 ranges and 7 metadata columns:
##                   seqnames                 ranges strand |           tx_id
##                      <Rle>              <IRanges>  <Rle> |     <character>
##   ENST00000335953       11 [113930315, 114121398]      + | ENST00000335953
##   ENST00000541602       11 [113930447, 114060486]      + | ENST00000541602
##   ENST00000544220       11 [113930459, 113934368]      + | ENST00000544220
##   ENST00000535700       11 [113930979, 113934466]      + | ENST00000535700
##   ENST00000392996       11 [113931229, 114121374]      + | ENST00000392996
##   ENST00000539918       11 [113935134, 114118066]      + | ENST00000539918
##   ENST00000545851       11 [114051488, 114118018]      + | ENST00000545851
##   ENST00000535379       11 [114107929, 114121279]      + | ENST00000535379
##   ENST00000535509       11 [114117512, 114121198]      + | ENST00000535509
##                                tx_biotype tx_cds_seq_start tx_cds_seq_end
##                               <character>        <integer>      <integer>
##   ENST00000335953          protein_coding        113934023      114121277
##   ENST00000541602         retained_intron             <NA>           <NA>
##   ENST00000544220          protein_coding        113934023      113934368
##   ENST00000535700          protein_coding        113934023      113934466
##   ENST00000392996          protein_coding        113934023      114121277
##   ENST00000539918 nonsense_mediated_decay        113935134      113992549
##   ENST00000545851    processed_transcript             <NA>           <NA>
##   ENST00000535379    processed_transcript             <NA>           <NA>
##   ENST00000535509         retained_intron             <NA>           <NA>
##                           gene_id         tx_name   gene_name
##                       <character>     <character> <character>
##   ENST00000335953 ENSG00000109906 ENST00000335953      ZBTB16
##   ENST00000541602 ENSG00000109906 ENST00000541602      ZBTB16
##   ENST00000544220 ENSG00000109906 ENST00000544220      ZBTB16
##   ENST00000535700 ENSG00000109906 ENST00000535700      ZBTB16
##   ENST00000392996 ENSG00000109906 ENST00000392996      ZBTB16
##   ENST00000539918 ENSG00000109906 ENST00000539918      ZBTB16
##   ENST00000545851 ENSG00000109906 ENST00000545851      ZBTB16
##   ENST00000535379 ENSG00000109906 ENST00000535379      ZBTB16
##   ENST00000535509 ENSG00000109906 ENST00000535509      ZBTB16
##   -------
##   seqinfo: 1 sequence from GRCh37 genome

Filter expression have to be written as a formula (i.e. starting with a ~) in the form column name followed by the logical condition.

To get an overview of database tables and available columns the function listTables can be used. The method listColumns on the other hand lists columns for the specified database table.

## list all database tables along with their columns
listTables(edb)
## $gene
##  [1] "gene_id"          "gene_name"        "entrezid"        
##  [4] "gene_biotype"     "gene_seq_start"   "gene_seq_end"    
##  [7] "seq_name"         "seq_strand"       "seq_coord_system"
## [10] "symbol"          
## 
## $tx
## [1] "tx_id"            "tx_biotype"       "tx_seq_start"    
## [4] "tx_seq_end"       "tx_cds_seq_start" "tx_cds_seq_end"  
## [7] "gene_id"          "tx_name"         
## 
## $tx2exon
## [1] "tx_id"    "exon_id"  "exon_idx"
## 
## $exon
## [1] "exon_id"        "exon_seq_start" "exon_seq_end"  
## 
## $chromosome
## [1] "seq_name"    "seq_length"  "is_circular"
## 
## $protein
## [1] "tx_id"            "protein_id"       "protein_sequence"
## 
## $uniprot
## [1] "protein_id"           "uniprot_id"           "uniprot_db"          
## [4] "uniprot_mapping_type"
## 
## $protein_domain
## [1] "protein_id"            "protein_domain_id"     "protein_domain_source"
## [4] "interpro_accession"    "prot_dom_start"        "prot_dom_end"         
## 
## $metadata
## [1] "name"  "value"
## list columns from a specific table
listColumns(edb, "tx")
## [1] "tx_id"            "tx_biotype"       "tx_seq_start"    
## [4] "tx_seq_end"       "tx_cds_seq_start" "tx_cds_seq_end"  
## [7] "gene_id"          "tx_name"

Thus, we could retrieve all transcripts of the biotype nonsense_mediated_decay (which, according to the definitions by Ensembl are transcribed, but most likely not translated in a protein, but rather degraded after transcription) along with the name of the gene for each transcript. Note that we are changing here the return.type to DataFrame, so the method will return a DataFrame with the results instead of the default GRanges.

Tx <- transcripts(edb,
          columns = c(listColumns(edb , "tx"), "gene_name"),
          filter = TxBiotypeFilter("nonsense_mediated_decay"),
          return.type = "DataFrame")
nrow(Tx)
## [1] 13812
Tx
## DataFrame with 13812 rows and 9 columns
##                 tx_id              tx_biotype tx_seq_start tx_seq_end
##           <character>             <character>    <integer>  <integer>
## 1     ENST00000495251 nonsense_mediated_decay        64085      69409
## 2     ENST00000462860 nonsense_mediated_decay        64085      69452
## 3     ENST00000483390 nonsense_mediated_decay        65739      68764
## 4     ENST00000538848 nonsense_mediated_decay        66411      68843
## 5     ENST00000567466 nonsense_mediated_decay        97578      99521
## ...               ...                     ...          ...        ...
## 13808 ENST00000496411 nonsense_mediated_decay    249149927  249153217
## 13809 ENST00000483223 nonsense_mediated_decay    249150714  249152728
## 13810 ENST00000533647 nonsense_mediated_decay    249151472  249152523
## 13811 ENST00000528141 nonsense_mediated_decay    249151590  249153284
## 13812 ENST00000530986 nonsense_mediated_decay    249151668  249153284
##       tx_cds_seq_start tx_cds_seq_end         gene_id         tx_name
##              <integer>      <integer>     <character>     <character>
## 1                68052          68789 ENSG00000234769 ENST00000495251
## 2                68052          68789 ENSG00000234769 ENST00000462860
## 3                66428          68764 ENSG00000234769 ENST00000483390
## 4                67418          68789 ENSG00000234769 ENST00000538848
## 5                98546          98893 ENSG00000261456 ENST00000567466
## ...                ...            ...             ...             ...
## 13808        249152153      249152508 ENSG00000171163 ENST00000496411
## 13809        249152153      249152508 ENSG00000171163 ENST00000483223
## 13810        249152153      249152508 ENSG00000171163 ENST00000533647
## 13811        249152203      249152508 ENSG00000171163 ENST00000528141
## 13812        249152203      249152508 ENSG00000171163 ENST00000530986
##         gene_name
##       <character>
## 1          WASH4P
## 2          WASH4P
## 3          WASH4P
## 4          WASH4P
## 5           TUBB8
## ...           ...
## 13808      ZNF692
## 13809      ZNF692
## 13810      ZNF692
## 13811      ZNF692
## 13812      ZNF692

For protein coding transcripts, we can also specifically extract their coding region. In the example below we extract the CDS for all transcripts encoded on chromosome Y.

yCds <- cdsBy(edb, filter = SeqNameFilter("Y"))
yCds
## GRangesList object of length 160:
## $ENST00000155093 
## GRanges object with 7 ranges and 3 metadata columns:
##       seqnames             ranges strand |    seq_name         exon_id
##          <Rle>          <IRanges>  <Rle> | <character>     <character>
##   [1]        Y [2821978, 2822038]      + |           Y ENSE00002223884
##   [2]        Y [2829115, 2829687]      + |           Y ENSE00003645989
##   [3]        Y [2843136, 2843285]      + |           Y ENSE00003548678
##   [4]        Y [2843552, 2843695]      + |           Y ENSE00003611496
##   [5]        Y [2844711, 2844863]      + |           Y ENSE00001649504
##   [6]        Y [2845981, 2846121]      + |           Y ENSE00001777381
##   [7]        Y [2846851, 2848034]      + |           Y ENSE00001368923
##       exon_rank
##       <integer>
##   [1]         2
##   [2]         3
##   [3]         4
##   [4]         5
##   [5]         6
##   [6]         7
##   [7]         8
## 
## $ENST00000215473 
## GRanges object with 6 ranges and 3 metadata columns:
##       seqnames             ranges strand | seq_name         exon_id
##   [1]        Y [4924865, 4925500]      + |        Y ENSE00001436852
##   [2]        Y [4966256, 4968748]      + |        Y ENSE00001640924
##   [3]        Y [5369098, 5369296]      + |        Y ENSE00001803775
##   [4]        Y [5483308, 5483316]      + |        Y ENSE00001731866
##   [5]        Y [5491131, 5491145]      + |        Y ENSE00001711324
##   [6]        Y [5605313, 5605983]      + |        Y ENSE00001779807
##       exon_rank
##   [1]         1
##   [2]         2
##   [3]         3
##   [4]         4
##   [5]         5
##   [6]         6
## 
## $ENST00000215479 
## GRanges object with 5 ranges and 3 metadata columns:
##       seqnames             ranges strand | seq_name         exon_id
##   [1]        Y [6740596, 6740649]      - |        Y ENSE00001671586
##   [2]        Y [6738047, 6738094]      - |        Y ENSE00001645681
##   [3]        Y [6736773, 6736817]      - |        Y ENSE00000652250
##   [4]        Y [6736078, 6736503]      - |        Y ENSE00001667251
##   [5]        Y [6734114, 6734119]      - |        Y ENSE00001494454
##       exon_rank
##   [1]         2
##   [2]         3
##   [3]         4
##   [4]         5
##   [5]         6
## 
## ...
## <157 more elements>
## -------
## seqinfo: 1 sequence from GRCh37 genome

Using a GRangesFilter we can retrieve all features from the database that are either within or overlapping the specified genomic region. In the example below we query all genes that are partially overlapping with a small region on chromosome 11. The filter restricts to all genes for which either an exon or an intron is partially overlapping with the region.

## Define the filter
grf <- GRangesFilter(GRanges("11", ranges = IRanges(114000000, 114000050),
                 strand = "+"), type = "any")

## Query genes:
gn <- genes(edb, filter = grf)
gn
## GRanges object with 1 range and 6 metadata columns:
##                   seqnames                 ranges strand |         gene_id
##                      <Rle>              <IRanges>  <Rle> |     <character>
##   ENSG00000109906       11 [113930315, 114121398]      + | ENSG00000109906
##                     gene_name    entrezid   gene_biotype seq_coord_system
##                   <character> <character>    <character>      <character>
##   ENSG00000109906      ZBTB16        7704 protein_coding       chromosome
##                        symbol
##                   <character>
##   ENSG00000109906      ZBTB16
##   -------
##   seqinfo: 1 sequence from GRCh37 genome
## Next we retrieve all transcripts for that gene so that we can plot them.
txs <- transcripts(edb, filter = GenenameFilter(gn$gene_name))
plot(3, 3, pch = NA, xlim = c(start(gn), end(gn)), ylim = c(0, length(txs)),
     yaxt = "n", ylab = "")
## Highlight the GRangesFilter region
rect(xleft = start(grf), xright = end(grf), ybottom = 0, ytop = length(txs),
     col = "red", border = "red")
for(i in 1:length(txs)) {
    current <- txs[i]
    rect(xleft = start(current), xright = end(current), ybottom = i-0.975,
     ytop = i-0.125, border = "grey")
    text(start(current), y = i-0.5, pos = 4, cex = 0.75, labels = current$tx_id)
}

As we can see, 4 transcripts of the gene ZBTB16 are also overlapping the region. Below we fetch these 4 transcripts. Note, that a call to exons will not return any features from the database, as no exon is overlapping with the region.

transcripts(edb, filter = grf)
## GRanges object with 4 ranges and 6 metadata columns:
##                   seqnames                 ranges strand |           tx_id
##                      <Rle>              <IRanges>  <Rle> |     <character>
##   ENST00000335953       11 [113930315, 114121398]      + | ENST00000335953
##   ENST00000541602       11 [113930447, 114060486]      + | ENST00000541602
##   ENST00000392996       11 [113931229, 114121374]      + | ENST00000392996
##   ENST00000539918       11 [113935134, 114118066]      + | ENST00000539918
##                                tx_biotype tx_cds_seq_start tx_cds_seq_end
##                               <character>        <integer>      <integer>
##   ENST00000335953          protein_coding        113934023      114121277
##   ENST00000541602         retained_intron             <NA>           <NA>
##   ENST00000392996          protein_coding        113934023      114121277
##   ENST00000539918 nonsense_mediated_decay        113935134      113992549
##                           gene_id         tx_name
##                       <character>     <character>
##   ENST00000335953 ENSG00000109906 ENST00000335953
##   ENST00000541602 ENSG00000109906 ENST00000541602
##   ENST00000392996 ENSG00000109906 ENST00000392996
##   ENST00000539918 ENSG00000109906 ENST00000539918
##   -------
##   seqinfo: 1 sequence from GRCh37 genome

The GRangesFilter supports also GRanges defining multiple regions and a query will return all features overlapping any of these regions. Besides using the GRangesFilter it is also possible to search for transcripts or exons overlapping genomic regions using the exonsByOverlaps or transcriptsByOverlaps known from the GenomicFeatures package. Note that the implementation of these methods for EnsDb objects supports also to use filters to further fine-tune the query.

The functions listGenebiotypes and listTxbiotypes can be used to get an overview of allowed/available gene and transcript biotype

## Get all gene biotypes from the database. The GeneBiotypeFilter
## allows to filter on these values.
listGenebiotypes(edb)
##  [1] "protein_coding"           "pseudogene"              
##  [3] "processed_transcript"     "antisense"               
##  [5] "lincRNA"                  "polymorphic_pseudogene"  
##  [7] "IG_V_pseudogene"          "IG_V_gene"               
##  [9] "sense_overlapping"        "sense_intronic"          
## [11] "TR_V_gene"                "misc_RNA"                
## [13] "snRNA"                    "miRNA"                   
## [15] "snoRNA"                   "rRNA"                    
## [17] "Mt_tRNA"                  "Mt_rRNA"                 
## [19] "IG_C_gene"                "IG_J_gene"               
## [21] "TR_J_gene"                "TR_C_gene"               
## [23] "TR_V_pseudogene"          "TR_J_pseudogene"         
## [25] "IG_D_gene"                "IG_C_pseudogene"         
## [27] "TR_D_gene"                "IG_J_pseudogene"         
## [29] "3prime_overlapping_ncrna" "processed_pseudogene"    
## [31] "LRG_gene"
## Get all transcript biotypes from the database.
listTxbiotypes(edb)
##  [1] "protein_coding"                    
##  [2] "processed_transcript"              
##  [3] "retained_intron"                   
##  [4] "nonsense_mediated_decay"           
##  [5] "unitary_pseudogene"                
##  [6] "non_stop_decay"                    
##  [7] "unprocessed_pseudogene"            
##  [8] "processed_pseudogene"              
##  [9] "transcribed_unprocessed_pseudogene"
## [10] "antisense"                         
## [11] "lincRNA"                           
## [12] "polymorphic_pseudogene"            
## [13] "transcribed_processed_pseudogene"  
## [14] "miRNA"                             
## [15] "pseudogene"                        
## [16] "IG_V_pseudogene"                   
## [17] "snoRNA"                            
## [18] "IG_V_gene"                         
## [19] "sense_overlapping"                 
## [20] "sense_intronic"                    
## [21] "TR_V_gene"                         
## [22] "snRNA"                             
## [23] "misc_RNA"                          
## [24] "rRNA"                              
## [25] "Mt_tRNA"                           
## [26] "Mt_rRNA"                           
## [27] "IG_C_gene"                         
## [28] "IG_J_gene"                         
## [29] "TR_J_gene"                         
## [30] "TR_C_gene"                         
## [31] "TR_V_pseudogene"                   
## [32] "TR_J_pseudogene"                   
## [33] "IG_D_gene"                         
## [34] "IG_C_pseudogene"                   
## [35] "TR_D_gene"                         
## [36] "IG_J_pseudogene"                   
## [37] "3prime_overlapping_ncrna"          
## [38] "translated_processed_pseudogene"   
## [39] "LRG_gene"

Data can be fetched in an analogous way using the exons and genes methods. In the example below we retrieve gene_name, entrezid and the gene_biotype of all genes in the database which names start with “BCL2”.

## We're going to fetch all genes which names start with BCL. To this end
## we define a GenenameFilter with partial matching, i.e. condition "like"
## and a % for any character/string.
BCLs <- genes(edb,
          columns = c("gene_name", "entrezid", "gene_biotype"),
          filter = GenenameFilter("BCL", condition = "startsWith"),
          return.type = "DataFrame")
nrow(BCLs)
## [1] 25
BCLs
## DataFrame with 25 rows and 4 columns
##       gene_name    entrezid   gene_biotype         gene_id
##     <character> <character>    <character>     <character>
## 1         BCL10        8915 protein_coding ENSG00000142867
## 2        BCL11A       53335 protein_coding ENSG00000119866
## 3        BCL11B       64919 protein_coding ENSG00000127152
## 4          BCL2         596 protein_coding ENSG00000171791
## 5        BCL2A1         597 protein_coding ENSG00000140379
## ...         ...         ...            ...             ...
## 21        BCL7C        9274 protein_coding ENSG00000099385
## 22         BCL9         607 protein_coding ENSG00000116128
## 23         BCL9         607 protein_coding ENSG00000266095
## 24        BCL9L      283149 protein_coding ENSG00000186174
## 25       BCLAF1        9774 protein_coding ENSG00000029363

Sometimes it might be useful to know the length of genes or transcripts (i.e. the total sum of nucleotides covered by their exons). Below we calculate the mean length of transcripts from protein coding genes on chromosomes X and Y as well as the average length of snoRNA, snRNA and rRNA transcripts encoded on these chromosomes. For the first query we combine two AnnotationFilter objects using an AnnotationFilterList object, in the second we define the query using a filter expression.

## determine the average length of snRNA, snoRNA and rRNA genes encoded on
## chromosomes X and Y.
mean(lengthOf(edb, of = "tx", filter = AnnotationFilterList(
                  GeneBiotypeFilter(c("snRNA", "snoRNA", "rRNA")),
                  SeqNameFilter(c("X", "Y")))))
## [1] 116.3046
## determine the average length of protein coding genes encoded on the same
## chromosomes.
mean(lengthOf(edb, of = "tx", filter = ~ gene_biotype == "protein_coding" &
                  seq_name %in% c("X", "Y")))
## [1] 1920

Not unexpectedly, transcripts of protein coding genes are longer than those of snRNA, snoRNA or rRNA genes.

At last we extract the first two exons of each transcript model from the database.

## Extract all exons 1 and (if present) 2 for all genes encoded on the
## Y chromosome
exons(edb, columns = c("tx_id", "exon_idx"),
      filter = list(SeqNameFilter("Y"),
            ExonRankFilter(3, condition = "<")))
## GRanges object with 1287 ranges and 3 metadata columns:
##                   seqnames               ranges strand |           tx_id
##                      <Rle>            <IRanges>  <Rle> |     <character>
##   ENSE00002088309        Y   [2652790, 2652894]      + | ENST00000516032
##   ENSE00001494622        Y   [2654896, 2655740]      - | ENST00000383070
##   ENSE00002323146        Y   [2655049, 2655069]      - | ENST00000525526
##   ENSE00002201849        Y   [2655075, 2655644]      - | ENST00000525526
##   ENSE00002214525        Y   [2655145, 2655168]      - | ENST00000534739
##               ...      ...                  ...    ... .             ...
##   ENSE00001632993        Y [28737695, 28737748]      - | ENST00000456738
##   ENSE00001616687        Y [28772667, 28773306]      - | ENST00000435741
##   ENSE00001638296        Y [28779492, 28779578]      - | ENST00000435945
##   ENSE00001797328        Y [28780670, 28780799]      - | ENST00000435945
##   ENSE00001794473        Y [59001391, 59001635]      + | ENST00000431853
##                    exon_idx         exon_id
##                   <integer>     <character>
##   ENSE00002088309         1 ENSE00002088309
##   ENSE00001494622         1 ENSE00001494622
##   ENSE00002323146         2 ENSE00002323146
##   ENSE00002201849         1 ENSE00002201849
##   ENSE00002214525         2 ENSE00002214525
##               ...       ...             ...
##   ENSE00001632993         1 ENSE00001632993
##   ENSE00001616687         1 ENSE00001616687
##   ENSE00001638296         2 ENSE00001638296
##   ENSE00001797328         1 ENSE00001797328
##   ENSE00001794473         1 ENSE00001794473
##   -------
##   seqinfo: 1 sequence from GRCh37 genome

3 Extracting gene/transcript/exon models for RNASeq feature counting

For the feature counting step of an RNAseq experiment, the gene or transcript models (defined by the chromosomal start and end positions of their exons) have to be known. To extract these from an Ensembl based annotation package, the exonsBy, genesBy and transcriptsBy methods can be used in an analogous way as in TxDb packages generated by the GenomicFeatures package. However, the transcriptsBy method does not, in contrast to the method in the GenomicFeatures package, allow to return transcripts by “cds”. While the annotation packages built by the ensembldb contain the chromosomal start and end coordinates of the coding region (for protein coding genes) they do not assign an ID to each CDS.

A simple use case is to retrieve all genes encoded on chromosomes X and Y from the database.

TxByGns <- transcriptsBy(edb, by = "gene", filter = SeqNameFilter(c("X", "Y")))
TxByGns
## GRangesList object of length 2908:
## $ENSG00000000003 
## GRanges object with 3 ranges and 6 metadata columns:
##       seqnames               ranges strand |           tx_id
##          <Rle>            <IRanges>  <Rle> |     <character>
##   [1]        X [99888439, 99894988]      - | ENST00000494424
##   [2]        X [99883667, 99891803]      - | ENST00000373020
##   [3]        X [99887538, 99891686]      - | ENST00000496771
##                 tx_biotype tx_cds_seq_start tx_cds_seq_end         gene_id
##                <character>        <integer>      <integer>     <character>
##   [1] processed_transcript             <NA>           <NA> ENSG00000000003
##   [2]       protein_coding         99885795       99891691 ENSG00000000003
##   [3] processed_transcript             <NA>           <NA> ENSG00000000003
##               tx_name
##           <character>
##   [1] ENST00000494424
##   [2] ENST00000373020
##   [3] ENST00000496771
## 
## $ENSG00000000005 
## GRanges object with 2 ranges and 6 metadata columns:
##       seqnames               ranges strand |           tx_id
##   [1]        X [99839799, 99854882]      + | ENST00000373031
##   [2]        X [99848621, 99852528]      + | ENST00000485971
##                 tx_biotype tx_cds_seq_start tx_cds_seq_end         gene_id
##   [1]       protein_coding         99840016       99854714 ENSG00000000005
##   [2] processed_transcript             <NA>           <NA> ENSG00000000005
##               tx_name
##   [1] ENST00000373031
##   [2] ENST00000485971
## 
## $ENSG00000001497 
## GRanges object with 6 ranges and 6 metadata columns:
##       seqnames               ranges strand |           tx_id
##   [1]        X [64732463, 64754655]      - | ENST00000484069
##   [2]        X [64732462, 64754636]      - | ENST00000374811
##   [3]        X [64732463, 64754636]      - | ENST00000374804
##   [4]        X [64732463, 64754636]      - | ENST00000312391
##   [5]        X [64732462, 64754634]      - | ENST00000374807
##   [6]        X [64740309, 64743497]      - | ENST00000469091
##                    tx_biotype tx_cds_seq_start tx_cds_seq_end
##   [1] nonsense_mediated_decay         64744901       64754595
##   [2]          protein_coding         64732655       64754595
##   [3]          protein_coding         64732655       64754595
##   [4]          protein_coding         64744901       64754595
##   [5]          protein_coding         64732655       64754595
##   [6]          protein_coding         64740535       64743497
##               gene_id         tx_name
##   [1] ENSG00000001497 ENST00000484069
##   [2] ENSG00000001497 ENST00000374811
##   [3] ENSG00000001497 ENST00000374804
##   [4] ENSG00000001497 ENST00000312391
##   [5] ENSG00000001497 ENST00000374807
##   [6] ENSG00000001497 ENST00000469091
## 
## ...
## <2905 more elements>
## -------
## seqinfo: 2 sequences from GRCh37 genome

Since Ensembl contains also definitions of genes that are on chromosome variants (supercontigs), it is advisable to specify the chromosome names for which the gene models should be returned.

In a real use case, we might thus want to retrieve all genes encoded on the standard chromosomes. In addition it is advisable to use a GeneIdFilter to restrict to Ensembl genes only, as also LRG (Locus Reference Genomic) genes2 are defined in the database, which are partially redundant with Ensembl genes.

## will just get exons for all genes on chromosomes 1 to 22, X and Y.
## Note: want to get rid of the "LRG" genes!!!
EnsGenes <- exonsBy(edb, by = "gene", filter = AnnotationFilterList(
                      SeqNameFilter(c(1:22, "X", "Y")),
                      GeneIdFilter("ENSG", "startsWith")))

The code above returns a GRangesList that can be used directly as an input for the summarizeOverlaps function from the GenomicAlignments package 3.

Alternatively, the above GRangesList can be transformed to a data.frame in SAF format that can be used as an input to the featureCounts function of the Rsubread package 4.

## Transforming the GRangesList into a data.frame in SAF format
EnsGenes.SAF <- toSAF(EnsGenes)

Note that the ID by which the GRangesList is split is used in the SAF formatted data.frame as the GeneID. In the example below this would be the Ensembl gene IDs, while the start, end coordinates (along with the strand and chromosomes) are those of the the exons.

In addition, the disjointExons function (similar to the one defined in GenomicFeatures) can be used to generate a GRanges of non-overlapping exon parts which can be used in the DEXSeq package.

## Create a GRanges of non-overlapping exon parts.
DJE <- disjointExons(edb, filter = AnnotationFilterList(
                  SeqNameFilter(c(1:22, "X", "Y")),
                  GeneIdFilter("ENSG%", "startsWith")))

4 Retrieving sequences for gene/transcript/exon models

The methods to retrieve exons, transcripts and genes (i.e. exons, transcripts and genes) return by default GRanges objects that can be used to retrieve sequences using the getSeq method e.g. from BSgenome packages. The basic workflow is thus identical to the one for TxDb packages, however, it is not straight forward to identify the BSgenome package with the matching genomic sequence. Most BSgenome packages are named according to the genome build identifier used in UCSC which does not (always) match the genome build name used by Ensembl. Using the Ensembl version provided by the EnsDb, the correct genomic sequence can however be retrieved easily from the AnnotationHub using the getGenomeFaFile. If no Fasta file matching the Ensembl version is available, the function tries to identify a Fasta file with the correct genome build from the closest Ensembl release and returns that instead.

In the code block below we retrieve first the FaFile with the genomic DNA sequence, extract the genomic start and end coordinates for all genes defined in the package, subset to genes encoded on sequences available in the FaFile and extract all of their sequences. Note: these sequences represent the sequence between the chromosomal start and end coordinates of the gene.

library(EnsDb.Hsapiens.v75)
library(Rsamtools)
edb <- EnsDb.Hsapiens.v75

## Get the FaFile with the genomic sequence matching the Ensembl version
## using the AnnotationHub package.
Dna <- getGenomeFaFile(edb)

## Get start/end coordinates of all genes.
genes <- genes(edb)
## Subset to all genes that are encoded on chromosomes for which
## we do have DNA sequence available.
genes <- genes[seqnames(genes) %in% seqnames(seqinfo(Dna))]

## Get the gene sequences, i.e. the sequence including the sequence of
## all of the gene's exons and introns.
geneSeqs <- getSeq(Dna, genes)

To retrieve the (exonic) sequence of transcripts (i.e. without introns) we can use directly the extractTranscriptSeqs method defined in the GenomicFeatures on the EnsDb object, eventually using a filter to restrict the query.

## get all exons of all transcripts encoded on chromosome Y
yTx <- exonsBy(edb, filter = SeqNameFilter("Y"))

## Retrieve the sequences for these transcripts from the FaFile.
library(GenomicFeatures)
yTxSeqs <- extractTranscriptSeqs(Dna, yTx)
yTxSeqs

## Extract the sequences of all transcripts encoded on chromosome Y.
yTx <- extractTranscriptSeqs(Dna, edb, filter = SeqNameFilter("Y"))

## Along these lines, we could use the method also to retrieve the coding sequence
## of all transcripts on the Y chromosome.
cdsY <- cdsBy(edb, filter = SeqNameFilter("Y"))
extractTranscriptSeqs(Dna, cdsY)

Note: in the next section we describe how transcript sequences can be retrieved from a BSgenome package that is based on UCSC, not Ensembl.

5 Integrating annotations from Ensembl based EnsDb packages with UCSC based annotations

Sometimes it might be useful to combine (Ensembl based) annotations from EnsDb packages/objects with annotations from other Bioconductor packages, that might base on UCSC annotations. To support such an integration of annotations, the ensembldb packages implements the seqlevelsStyle and seqlevelsStyle<- from the GenomeInfoDb package that allow to change the style of chromosome naming. Thus, sequence/chromosome names other than those used by Ensembl can be used in, and are returned by, the queries to EnsDb objects as long as a mapping for them is provided by the GenomeInfoDb package (which provides a mapping mostly between UCSC, NCBI and Ensembl chromosome names for the main chromosomes).

In the example below we change the seqnames style to UCSC.

## Change the seqlevels style form Ensembl (default) to UCSC:
seqlevelsStyle(edb) <- "UCSC"

## Now we can use UCSC style seqnames in SeqNameFilters or GRangesFilter:
genesY <- genes(edb, filter = ~ seq_name == "chrY")
## The seqlevels of the returned GRanges are also in UCSC style
seqlevels(genesY)
## [1] "chrY"

Note that in most instances no mapping is available for sequences not corresponding to the main chromosomes (i.e. contigs, patched chromosomes etc). What is returned in cases in which no mapping is available can be specified with the global ensembldb.seqnameNotFound option. By default (with ensembldb.seqnameNotFound set to “ORIGINAL”), the original seqnames (i.e. the ones from Ensembl) are returned. With ensembldb.seqnameNotFound “MISSING” each time a seqname can not be found an error is thrown. For all other cases (e.g. ensembldb.seqnameNotFound = NA) the value of the option is returned.

seqlevelsStyle(edb) <- "UCSC"

## Getting the default option:
getOption("ensembldb.seqnameNotFound")
## [1] "ORIGINAL"
## Listing all seqlevels in the database.
seqlevels(edb)[1:30]
## Warning in .formatSeqnameByStyleFromQuery(x, sn, ifNotFound): More than 5
## seqnames with seqlevels style of the database (Ensembl) could not be mapped
## to the seqlevels style: UCSC!) Returning the orginal seqnames for these.
##  [1] "chr1"       "chr10"      "chr11"      "chr12"      "chr13"     
##  [6] "chr14"      "chr15"      "chr16"      "chr17"      "chr18"     
## [11] "chr19"      "chr2"       "chr20"      "chr21"      "chr22"     
## [16] "chr3"       "chr4"       "chr5"       "chr6"       "chr7"      
## [21] "chr8"       "chr9"       "GL000191.1" "GL000192.1" "GL000193.1"
## [26] "GL000194.1" "GL000195.1" "GL000196.1" "GL000199.1" "GL000201.1"
## Setting the option to NA, thus, for each seqname for which no mapping is available,
## NA is returned.
options(ensembldb.seqnameNotFound=NA)
seqlevels(edb)[1:30]
## Warning in .formatSeqnameByStyleFromQuery(x, sn, ifNotFound): More than 5
## seqnames with seqlevels style of the database (Ensembl) could not be mapped
## to the seqlevels style: UCSC!) Returning NA for these.
##  [1] "chr1"  "chr10" "chr11" "chr12" "chr13" "chr14" "chr15" "chr16" "chr17"
## [10] "chr18" "chr19" "chr2"  "chr20" "chr21" "chr22" "chr3"  "chr4"  "chr5" 
## [19] "chr6"  "chr7"  "chr8"  "chr9"  NA      NA      NA      NA      NA     
## [28] NA      NA      NA
## Resetting the option.
options(ensembldb.seqnameNotFound = "ORIGINAL")

Next we retrieve transcript sequences from genes encoded on chromosome Y using the BSGenome package for the human genome from UCSC. The specified version hg19 matches the genome build of Ensembl version 75, i.e. GRCh37. Note that while we changed the style of the seqnames to UCSC we did not change the naming of the genome release.

library(BSgenome.Hsapiens.UCSC.hg19)
bsg <- BSgenome.Hsapiens.UCSC.hg19

## Get the genome version
unique(genome(bsg))
## [1] "hg19"
unique(genome(edb))
## [1] "GRCh37"
## Although differently named, both represent genome build GRCh37.

## Extract the full transcript sequences.
yTxSeqs <- extractTranscriptSeqs(bsg, exonsBy(edb, "tx",
                          filter = SeqNameFilter("chrY")))

yTxSeqs
##   A DNAStringSet instance of length 731
##       width seq                                          names               
##   [1]  5239 GCCTAGTGCGCGCGCAGTAAC...TAAATGTTTACTTGTATATG ENST00000155093
##   [2]  4023 ATGTTTAGGGTTGGCTTCTTA...TGGAAACACATCCCTTGTAA ENST00000215473
##   [3]   802 AGAGGACCAAGCCTCCCTGTG...ATAAAATGTTTTAAAAATCA ENST00000215479
##   [4]   910 TGTCTGTCAGAGCTGTCAGCC...AACACTGGTATATTTCTGTT ENST00000250776
##   [5]  1305 TTCCAGGATATGAACTCTACA...AATCCTGTGGCTGTAGGAAA ENST00000250784
##   ...   ... ...
## [727]   333 ATGGATGAAGAAGAGAAAACC...GTGAACTTTCTAGATTGCAT ENST00000604924
## [728]  1247 CATGGCGGGGTTCCTGCCTTC...CTTTGGAGTAATGTCTTAGT ENST00000605584
## [729]   199 CAGTTCTCGCTCCTGTGCAGC...TGGTCTGGGTGGCTTCTGGA ENST00000605663
## [730]   276 GCCCCAGGAGGAAAGGGGGAC...AAATAAAGAACAGCGCATTC ENST00000606439
## [731]   444 ATGGGAGCCACTGGGCTTGGC...ACGTTCATGAAGAAGACTAA ENST00000607210
## Extract just the CDS
Test <- cdsBy(edb, "tx", filter = SeqNameFilter("chrY"))
yTxCds <- extractTranscriptSeqs(bsg, cdsBy(edb, "tx",
                       filter = SeqNameFilter("chrY")))
yTxCds
##   A DNAStringSet instance of length 160
##       width seq                                          names               
##   [1]  2406 ATGGATGAAGATGAATTTGAA...AAGAAGTTGGTCTGCCCTAA ENST00000155093
##   [2]  4023 ATGTTTAGGGTTGGCTTCTTA...TGGAAACACATCCCTTGTAA ENST00000215473
##   [3]   579 ATGGGGACCTGGATTTTGTTT...AGCAGGAGGAAGTGGATTAA ENST00000215479
##   [4]   792 ATGGCCCGGGGCCCCAAGAAG...CCAAACAGAGCAGTGGCTAA ENST00000250784
##   [5]   378 ATGAGTCCAAAGCCGAGAGCC...CTACTCCCCTATCTCCCTGA ENST00000250823
##   ...   ... ...
## [156]    63 CGCAAGGATTTAAAAGAGATG...CACCCTGTTGGCCAGGCTAG ENST00000601700
## [157]    42 CTTGATACAAAGAATCAATTTAATTTTAAGATTGTCTATCTT   ENST00000601705
## [158]    33 ATGATGACGCTTGTCCCCAGAGCCAGGACACGT            ENST00000602680
## [159]    33 ATGATGACGCTTGTCCCCAGAGCCAGGACACGT            ENST00000602732
## [160]    33 ATGATGACGCTTGTCCCCAGAGCCAGGACACGT            ENST00000602770

At last changing the seqname style to the default value "Ensembl".

seqlevelsStyle(edb) <- "Ensembl"

6 Interactive annotation lookup using the shiny web app

In addition to the genes, transcripts and exons methods it is possibly to search interactively for gene/transcript/exon annotations using the internal, shiny based, web application. The application can be started with the runEnsDbApp() function. The search results from this app can also be returned to the R workspace either as a data.frame or GRanges object.

7 Plotting gene/transcript features using ensembldb and Gviz and ggbio

The Gviz package provides functions to plot genes and transcripts along with other data on a genomic scale. Gene models can be provided either as a data.frame, GRanges, TxDB database, can be fetched from biomart and can also be retrieved from ensembldb.

Below we generate a GeneRegionTrack fetching all transcripts from a certain region on chromosome Y.

Note that if we want in addition to work also with BAM files that were aligned against DNA sequences retrieved from Ensembl or FASTA files representing genomic DNA sequences from Ensembl we should change the ucscChromosomeNames option from Gviz to FALSE (i.e. by calling options(ucscChromosomeNames = FALSE)). This is not necessary if we just want to retrieve gene models from an EnsDb object, as the ensembldb package internally checks the ucscChromosomeNames option and, depending on that, maps Ensembl chromosome names to UCSC chromosome names.

## Loading the Gviz library
library(Gviz)
library(EnsDb.Hsapiens.v75)
edb <- EnsDb.Hsapiens.v75

## Retrieving a Gviz compatible GRanges object with all genes
## encoded on chromosome Y.
gr <- getGeneRegionTrackForGviz(edb, chromosome = "Y",
                start = 20400000, end = 21400000)
## Define a genome axis track
gat <- GenomeAxisTrack()

## We have to change the ucscChromosomeNames option to FALSE to enable Gviz usage
## with non-UCSC chromosome names.
options(ucscChromosomeNames = FALSE)

plotTracks(list(gat, GeneRegionTrack(gr)))

options(ucscChromosomeNames = TRUE)

Above we had to change the option ucscChromosomeNames to FALSE in order to use it with non-UCSC chromosome names. Alternatively, we could however also change the seqnamesStyle of the EnsDb object to UCSC. Note that we have to use now also chromosome names in the UCSC style in the SeqNameFilter (i.e. “chrY” instead of Y).

seqlevelsStyle(edb) <- "UCSC"
## Retrieving the GRanges objects with seqnames corresponding to UCSC chromosome names.
gr <- getGeneRegionTrackForGviz(edb, chromosome = "chrY",
                start = 20400000, end = 21400000)
## Warning in .formatSeqnameByStyleForQuery(x, sn, ifNotFound): Seqnames:
## Y could not be mapped to the seqlevels style of the database (Ensembl)!
## Returning the orginal seqnames for these.
seqnames(gr)
## factor-Rle of length 218 with 1 run
##   Lengths:  218
##   Values : chrY
## Levels(1): chrY
## Define a genome axis track
gat <- GenomeAxisTrack()
plotTracks(list(gat, GeneRegionTrack(gr)))

We can also use the filters from the ensembldb package to further refine what transcripts are fetched, like in the example below, in which we create two different gene region tracks, one for protein coding genes and one for lincRNAs.

protCod <- getGeneRegionTrackForGviz(edb, chromosome = "chrY",
                     start = 20400000, end = 21400000,
                     filter = GeneBiotypeFilter("protein_coding"))
lincs <- getGeneRegionTrackForGviz(edb, chromosome = "chrY",
                   start = 20400000, end = 21400000,
                   filter = GeneBiotypeFilter("lincRNA"))

plotTracks(list(gat, GeneRegionTrack(protCod, name = "protein coding"),
        GeneRegionTrack(lincs, name = "lincRNAs")), transcriptAnnotation = "symbol")

## At last we change the seqlevels style again to Ensembl
seqlevelsStyle <- "Ensembl"

Alternatively, we can also use ggbio for plotting. For ggplot we can directly pass the EnsDb object along with optional filters (or as in the example below a filter expression as a formula).

library(ggbio)

## Create a plot for all transcripts of the gene SKA2
autoplot(edb, ~ genename == "SKA2")

To plot the genomic region and plot genes from both strands we can use a GRangesFilter.

## Get the chromosomal region in which the gene is encoded
ska2 <- genes(edb, filter = ~ genename == "SKA2")
strand(ska2) <- "*"
autoplot(edb, GRangesFilter(ska2), names.expr = "gene_name")

8 Using EnsDb objects in the AnnotationDbi framework

Most of the methods defined for objects extending the basic annotation package class AnnotationDbi are also defined for EnsDb objects (i.e. methods columns, keytypes, keys, mapIds and select). While these methods can be used analogously to basic annotation packages, the implementation for EnsDb objects also support the filtering framework of the ensembldb package.

In the example below we first evaluate all the available columns and keytypes in the database and extract then the gene names for all genes encoded on chromosome X.

library(EnsDb.Hsapiens.v75)
edb <- EnsDb.Hsapiens.v75

## List all available columns in the database.
columns(edb)
##  [1] "ENTREZID"            "EXONID"              "EXONIDX"            
##  [4] "EXONSEQEND"          "EXONSEQSTART"        "GENEBIOTYPE"        
##  [7] "GENEID"              "GENENAME"            "GENESEQEND"         
## [10] "GENESEQSTART"        "INTERPROACCESSION"   "ISCIRCULAR"         
## [13] "PROTDOMEND"          "PROTDOMSTART"        "PROTEINDOMAINID"    
## [16] "PROTEINDOMAINSOURCE" "PROTEINID"           "PROTEINSEQUENCE"    
## [19] "SEQCOORDSYSTEM"      "SEQLENGTH"           "SEQNAME"            
## [22] "SEQSTRAND"           "SYMBOL"              "TXBIOTYPE"          
## [25] "TXCDSSEQEND"         "TXCDSSEQSTART"       "TXID"               
## [28] "TXNAME"              "TXSEQEND"            "TXSEQSTART"         
## [31] "UNIPROTDB"           "UNIPROTID"           "UNIPROTMAPPINGTYPE"
## Note that these do *not* correspond to the actual column names
## of the database that can be passed to methods like exons, genes,
## transcripts etc. These column names can be listed with the listColumns
## method.
listColumns(edb)
##  [1] "seq_name"              "seq_length"            "is_circular"          
##  [4] "exon_id"               "exon_seq_start"        "exon_seq_end"         
##  [7] "gene_id"               "gene_name"             "entrezid"             
## [10] "gene_biotype"          "gene_seq_start"        "gene_seq_end"         
## [13] "seq_strand"            "seq_coord_system"      "symbol"               
## [16] "name"                  "value"                 "tx_id"                
## [19] "protein_id"            "protein_sequence"      "protein_domain_id"    
## [22] "protein_domain_source" "interpro_accession"    "prot_dom_start"       
## [25] "prot_dom_end"          "tx_biotype"            "tx_seq_start"         
## [28] "tx_seq_end"            "tx_cds_seq_start"      "tx_cds_seq_end"       
## [31] "tx_name"               "exon_idx"              "uniprot_id"           
## [34] "uniprot_db"            "uniprot_mapping_type"
## List all of the supported key types.
keytypes(edb)
##  [1] "ENTREZID"        "EXONID"          "GENEBIOTYPE"     "GENEID"         
##  [5] "GENENAME"        "PROTEINDOMAINID" "PROTEINID"       "SEQNAME"        
##  [9] "SEQSTRAND"       "SYMBOL"          "TXBIOTYPE"       "TXID"           
## [13] "TXNAME"          "UNIPROTID"
## Get all gene ids from the database.
gids <- keys(edb, keytype = "GENEID")
length(gids)
## [1] 64102
## Get all gene names for genes encoded on chromosome Y.
gnames <- keys(edb, keytype = "GENENAME", filter = SeqNameFilter("Y"))
head(gnames)
## [1] "KDM5D"   "DDX3Y"   "ZFY"     "TBL1Y"   "PCDH11Y" "AMELY"

In the next example we retrieve specific information from the database using the select method. First we fetch all transcripts for the genes BCL2 and BCL2L11. In the first call we provide the gene names, while in the second call we employ the filtering system to perform a more fine-grained query to fetch only the protein coding transcripts for these genes.

## Use the /standard/ way to fetch data.
select(edb, keys = c("BCL2", "BCL2L11"), keytype = "GENENAME",
       columns = c("GENEID", "GENENAME", "TXID", "TXBIOTYPE"))
##             GENEID GENENAME            TXID               TXBIOTYPE
## 1  ENSG00000171791     BCL2 ENST00000398117          protein_coding
## 2  ENSG00000171791     BCL2 ENST00000333681          protein_coding
## 3  ENSG00000171791     BCL2 ENST00000590515    processed_transcript
## 4  ENSG00000171791     BCL2 ENST00000589955          protein_coding
## 5  ENSG00000171791     BCL2 ENST00000444484          protein_coding
## 6  ENSG00000153094  BCL2L11 ENST00000432179          protein_coding
## 7  ENSG00000153094  BCL2L11 ENST00000308659          protein_coding
## 8  ENSG00000153094  BCL2L11 ENST00000393256          protein_coding
## 9  ENSG00000153094  BCL2L11 ENST00000393252          protein_coding
## 10 ENSG00000153094  BCL2L11 ENST00000433098 nonsense_mediated_decay
## 11 ENSG00000153094  BCL2L11 ENST00000405953          protein_coding
## 12 ENSG00000153094  BCL2L11 ENST00000415458 nonsense_mediated_decay
## 13 ENSG00000153094  BCL2L11 ENST00000436733 nonsense_mediated_decay
## 14 ENSG00000153094  BCL2L11 ENST00000437029 nonsense_mediated_decay
## 15 ENSG00000153094  BCL2L11 ENST00000452231 nonsense_mediated_decay
## 16 ENSG00000153094  BCL2L11 ENST00000361493 nonsense_mediated_decay
## 17 ENSG00000153094  BCL2L11 ENST00000431217 nonsense_mediated_decay
## 18 ENSG00000153094  BCL2L11 ENST00000439718 nonsense_mediated_decay
## 19 ENSG00000153094  BCL2L11 ENST00000438054          protein_coding
## 20 ENSG00000153094  BCL2L11 ENST00000357757          protein_coding
## 21 ENSG00000153094  BCL2L11 ENST00000393253          protein_coding
## 22 ENSG00000153094  BCL2L11 ENST00000337565          protein_coding
## Use the filtering system of ensembldb
select(edb, keys = ~ genename %in% c("BCL2", "BCL2L11") &
        tx_biotype == "protein_coding",
       columns = c("GENEID", "GENENAME", "TXID", "TXBIOTYPE"))
##             GENEID GENENAME            TXID      TXBIOTYPE
## 1  ENSG00000171791     BCL2 ENST00000398117 protein_coding
## 2  ENSG00000171791     BCL2 ENST00000333681 protein_coding
## 3  ENSG00000171791     BCL2 ENST00000589955 protein_coding
## 4  ENSG00000171791     BCL2 ENST00000444484 protein_coding
## 5  ENSG00000153094  BCL2L11 ENST00000432179 protein_coding
## 6  ENSG00000153094  BCL2L11 ENST00000308659 protein_coding
## 7  ENSG00000153094  BCL2L11 ENST00000393256 protein_coding
## 8  ENSG00000153094  BCL2L11 ENST00000393252 protein_coding
## 9  ENSG00000153094  BCL2L11 ENST00000405953 protein_coding
## 10 ENSG00000153094  BCL2L11 ENST00000438054 protein_coding
## 11 ENSG00000153094  BCL2L11 ENST00000357757 protein_coding
## 12 ENSG00000153094  BCL2L11 ENST00000393253 protein_coding
## 13 ENSG00000153094  BCL2L11 ENST00000337565 protein_coding

Finally, we use the mapIds method to establish a mapping between ids and values. In the example below we fetch transcript ids for the two genes from the example above.

## Use the default method, which just returns the first value for multi mappings.
mapIds(edb, keys = c("BCL2", "BCL2L11"), column = "TXID", keytype = "GENENAME")
##              BCL2           BCL2L11 
## "ENST00000398117" "ENST00000432179"
## Alternatively, specify multiVals="list" to return all mappings.
mapIds(edb, keys = c("BCL2", "BCL2L11"), column = "TXID", keytype = "GENENAME",
       multiVals = "list")
## $BCL2
## [1] "ENST00000398117" "ENST00000333681" "ENST00000590515" "ENST00000589955"
## [5] "ENST00000444484"
## 
## $BCL2L11
##  [1] "ENST00000432179" "ENST00000308659" "ENST00000393256" "ENST00000393252"
##  [5] "ENST00000433098" "ENST00000405953" "ENST00000415458" "ENST00000436733"
##  [9] "ENST00000437029" "ENST00000452231" "ENST00000361493" "ENST00000431217"
## [13] "ENST00000439718" "ENST00000438054" "ENST00000357757" "ENST00000393253"
## [17] "ENST00000337565"
## And, just like before, we can use filters to map only to protein coding transcripts.
mapIds(edb, keys = list(GenenameFilter(c("BCL2", "BCL2L11")),
            TxBiotypeFilter("protein_coding")), column = "TXID",
       multiVals = "list")
## Warning in .mapIds(x = x, keys = keys, column = column, keytype = keytype, :
## Got 2 filter objects. Will use the keys of the first for the mapping!
## $BCL2
## [1] "ENST00000398117" "ENST00000333681" "ENST00000589955" "ENST00000444484"
## 
## $BCL2L11
## [1] "ENST00000432179" "ENST00000308659" "ENST00000393256" "ENST00000393252"
## [5] "ENST00000405953" "ENST00000438054" "ENST00000357757" "ENST00000393253"
## [9] "ENST00000337565"

Note that, if the filters are used, the ordering of the result does no longer match the ordering of the genes.

9 Important notes

These notes might explain eventually unexpected results (and, more importantly, help avoiding them):

  • The ordering of the results returned by the genes, exons, transcripts methods can be specified with the order.by parameter. The ordering of the results does however not correspond to the ordering of values in submitted filter objects. The exception is the select method. If a character vector of values or a single filter is passed with argument keys the ordering of results of this method matches the ordering of the key values or the values of the filter.

  • Results of exonsBy, transcriptsBy are always ordered by the by argument.

  • The CDS provided by EnsDb objects always includes both, the start and the stop codon.

  • Transcripts with multiple CDS are at present not supported by EnsDb.

  • At present, EnsDb support only genes/transcripts for which all of their exons are encoded on the same chromosome and the same strand.

  • Since a single Ensembl gene ID might be mapped to multiple NCBI Entrezgene IDs methods such as genes, transcripts etc return a list in the "entrezid" column of the resulting result object.

10 Getting or building EnsDb databases/packages

Some of the code in this section is not supposed to be automatically executed when the vignette is built, as this would require a working installation of the Ensembl Perl API, which is not expected to be available on each system. Also, building EnsDb from alternative sources, like GFF or GTF files takes some time and thus also these examples are not directly executed when the vignette is build.

10.1 Getting EnsDb databases

Some EnsDb databases are available as R packages from Bioconductor and can be simply installed with the biocLite function from the BiocInstaller package. The name of such annotation packages starts with EnsDb followed by the abbreviation of the organism and the Ensembl version on which the annotation bases. EnsDb.Hsapiens.v86 provides thus an EnsDb database for homo sapiens with annotations from Ensembl version 86.

Since Bioconductor version 3.5 EnsDb databases can also be retrieved directly from AnnotationHub.

library(AnnotationHub)
## Load the annotation resource.
ah <- AnnotationHub()

## Query for all available EnsDb databases
query(ah, "EnsDb")

We can simply fetch one of the databases.

ahDb <- query(ah, pattern = c("Xiphophorus Maculatus", "EnsDb", 87))
## What have we got
ahDb

Fetch the EnsDb and use it.

ahEdb <- ahDb[[1]]

## retriebe all genes
gns <- genes(ahEdb)

We could even make an annotation package from this EnsDb object using the makeEnsembldbPackage and passing dbfile(dbconn(ahEdb)) as ensdb argument.

10.2 Building annotation packages

10.2.1 Directly from Ensembl databases

The fetchTablesFromEnsembl function uses the Ensembl Perl API to retrieve the required annotations from an Ensembl database (e.g. from the main site ensembldb.ensembl.org). Thus, to use this functionality to build databases, the Ensembl Perl API needs to be installed (see 5 for details).

Below we create an EnsDb database by fetching the required data directly from the Ensembl core databases. The makeEnsembldbPackage function is then used to create an annotation package from this EnsDb containing all human genes for Ensembl version 75.

library(ensembldb)

## get all human gene/transcript/exon annotations from Ensembl (75)
## the resulting tables will be stored by default to the current working
## directory
fetchTablesFromEnsembl(75, species = "human")

## These tables can then be processed to generate a SQLite database
## containing the annotations (again, the function assumes the required
## txt files to be present in the current working directory)
DBFile <- makeEnsemblSQLiteFromTables()

## and finally we can generate the package
makeEnsembldbPackage(ensdb = DBFile, version = "0.99.12",
             maintainer = "Johannes Rainer <johannes.rainer@eurac.edu>",
             author = "J Rainer")

The generated package can then be build using R CMD build EnsDb.Hsapiens.v75 and installed with R CMD INSTALL EnsDb.Hsapiens.v75*. Note that we could directly generate an EnsDb instance by loading the database file, i.e. by calling edb <- EnsDb(DBFile) and work with that annotation object.

To fetch and build annotation packages for plant genomes (e.g. arabidopsis thaliana), the Ensembl genomes should be specified as a host, i.e. setting host to “mysql-eg-publicsql.ebi.ac.uk”, port to 4157 and species to e.g. “arabidopsis thaliana”.

10.2.2 From a GTF or GFF file

Alternatively, the ensDbFromAH, ensDbFromGff, ensDbFromGRanges and ensDbFromGtf functions allow to build EnsDb SQLite files from a GRanges object or GFF/GTF files from Ensembl (either provided as files or via AnnotationHub). These functions do not depend on the Ensembl Perl API, but require a working internet connection to fetch the chromosome lengths from Ensembl as these are not provided within GTF or GFF files. Also note that protein annotations are usually not available in GTF or GFF files, thus, such annotations will not be included in the generated EnsDb database - protein annotations are only available in EnsDb databases created with the Ensembl Perl API (such as the ones provided through AnnotationHub or as Bioconductor packages).

In the next example we create an EnsDb database using the AnnotationHub package and load also the corresponding genomic DNA sequence matching the Ensembl version. We thus first query the AnnotationHub package for all resources available for Mus musculus and the Ensembl release 77. Next we create the EnsDb object from the appropriate AnnotationHub resource. We then use the getGenomeFaFile method on the EnsDb to directly look up and retrieve the correct or best matching FaFile with the genomic DNA sequence. At last we retrieve the sequences of all exons using the getSeq method.

## Load the AnnotationHub data.
library(AnnotationHub)
ah <- AnnotationHub()

## Query all available files for Ensembl release 77 for
## Mus musculus.
query(ah, c("Mus musculus", "release-77"))

## Get the resource for the gtf file with the gene/transcript definitions.
Gtf <- ah["AH28822"]
## Create a EnsDb database file from this.
DbFile <- ensDbFromAH(Gtf)
## We can either generate a database package, or directly load the data
edb <- EnsDb(DbFile)


## Identify and get the FaFile object with the genomic DNA sequence matching
## the EnsDb annotation.
Dna <- getGenomeFaFile(edb)
library(Rsamtools)
## We next retrieve the sequence of all exons on chromosome Y.
exons <- exons(edb, filter = SeqNameFilter("Y"))
exonSeq <- getSeq(Dna, exons)

## Alternatively, look up and retrieve the toplevel DNA sequence manually.
Dna <- ah[["AH22042"]]

In the example below we load a GRanges containing gene definitions for genes encoded on chromosome Y and generate a EnsDb SQLite database from that information.

## Generate a sqlite database from a GRanges object specifying
## genes encoded on chromosome Y
load(system.file("YGRanges.RData", package = "ensembldb"))
Y

## Create the EnsDb database file
DB <- ensDbFromGRanges(Y, path = tempdir(), version = 75,
               organism = "Homo_sapiens")

## Load the database
edb <- EnsDb(DB)
edb

Alternatively we can build the annotation database using the ensDbFromGtf ensDbFromGff functions, that extract most of the required data from a GTF respectively GFF (version 3) file which can be downloaded from Ensembl (e.g. from ftp://ftp.ensembl.org/pub/release-75/gtf/homo_sapiens for human gene definitions from Ensembl version 75; for plant genomes etc, files can be retrieved from ftp://ftp.ensemblgenomes.org). All information except the chromosome lengths, the NCBI Entrezgene IDs and protein annotations can be extracted from these GTF files. The function also tries to retrieve chromosome length information automatically from Ensembl.

Below we create the annotation from a gtf file that we fetch directly from Ensembl.

library(ensembldb)

## the GTF file can be downloaded from
## ftp://ftp.ensembl.org/pub/release-75/gtf/homo_sapiens/
gtffile <- "Homo_sapiens.GRCh37.75.gtf.gz"
## generate the SQLite database file
DB <- ensDbFromGtf(gtf = gtffile)

## load the DB file directly
EDB <- EnsDb(DB)

## alternatively, build the annotation package
## and finally we can generate the package
makeEnsembldbPackage(ensdb = DB, version = "0.99.12",
             maintainer = "Johannes Rainer <johannes.rainer@eurac.edu>",
             author = "J Rainer")

11 Database layout

The database consists of the following tables and attributes (the layout is also shown in Figure 159). Note that the protein-specific annotations might not be available in all EnsDB databases (e.g. such ones created with ensembldb version < 1.7 or created from GTF or GFF files).

  • gene: all gene specific annotations.
    • gene_id: the Ensembl ID of the gene.
    • gene_name: the name (symbol) of the gene. <<<<<<< variant A
    • entrezid: the NCBI Entrezgene ID(s) of the gene. Note that this can be a ; separated list of IDs for genes that are mapped to more than one Entrezgene. >>>>>>> variant B ======= end
    • gene_biotype: the biotype of the gene.
    • gene_seq_start: the start coordinate of the gene on the sequence (usually a chromosome).
    • gene_seq_end: the end coordinate of the gene on the sequence.
    • seq_name: the name of the sequence (usually the chromosome name).
    • seq_strand: the strand on which the gene is encoded.
    • seq_coord_system: the coordinate system of the sequence.
  • entrezgene: mapping of Ensembl genes to NCBI Entrezgene identifiers. Note that this mapping can be a one-to-many mapping.
    • gene_id: the Ensembl gene ID.
    • entrezid: the NCBI Entrezgene ID.
  • tx: all transcript related annotations. Note that while no tx_name column is available in this database column, all methods to retrieve data from the database support also this column. The returned values are however the ID of the transcripts.
    • tx_id: the Ensembl transcript ID.
    • tx_biotype: the biotype of the transcript.
    • tx_seq_start: the start coordinate of the transcript.
    • tx_seq_end: the end coordinate of the transcript.
    • tx_cds_seq_start: the start coordinate of the coding region of the transcript (NULL for non-coding transcripts).
    • tx_cds_seq_end: the end coordinate of the coding region of the transcript.
    • gene_id: the gene to which the transcript belongs.
  • exon: all exon related annotation.
    • exon_id: the Ensembl exon ID.
    • exon_seq_start: the start coordinate of the exon.
    • exon_seq_end: the end coordinate of the exon.
  • tx2exon: provides the n:m mapping between transcripts and exons.
    • tx_id: the Ensembl transcript ID.
    • exon_id: the Ensembl exon ID.
    • exon_idx: the index of the exon in the corresponding transcript, always from 5’ to 3’ of the transcript.
  • chromosome: provides some information about the chromosomes.
    • seq_name: the name of the sequence/chromosome.
    • seq_length: the length of the sequence.
    • is_circular: whether the sequence in circular.
  • protein: provides protein annotation for a (coding) transcript.
    • protein_id: the Ensembl protein ID.
    • tx_id: the transcript ID which CDS encodes the protein.
    • protein_sequence: the peptide sequence of the protein (translated from the transcript’s coding sequence after applying eventual RNA editing).
  • uniprot: provides the mapping from Ensembl protein ID(s) to Uniprot ID(s). Not all Ensembl proteins are annotated to Uniprot IDs, also, each Ensembl protein might be mapped to multiple Uniprot IDs.
    • protein_id: the Ensembl protein ID.
    • uniprot_id: the Uniprot ID.
    • uniprot_db: the Uniprot database in which the ID is defined.
    • uniprot_mapping_type: the type of the mapping method that was used to assign the Uniprot ID to an Ensembl protein ID.
  • protein_domain: provides protein domain annotations and mapping to proteins.
    • protein_id: the Ensembl protein ID on which the protein domain is present.
    • protein_domain_id: the ID of the protein domain (from the protein domain source).
    • protein_domain_source: the source/analysis method in/by which the protein domain was defined (such as pfam etc).
    • interpro_accession: the Interpro accession ID of the protein domain.
    • prot_dom_start: the start position of the protein domain within the protein’s sequence.
    • prot_dom_end: the end position of the protein domain within the protein’s sequence.
  • metadata: some additional, internal, informations (Genome build, Ensembl version etc).
    • name
    • value
  • virtual columns:
    • symbol: the database does not have such a database column, but it is still possible to use it in the columns parameter. This column is symlinked to the gene_name column.
    • tx_name: similar to the symbol column, this column is symlinked to the tx_id column.

The database layout: as already described above, protein related annotations (green) might not be available in each EnsDb database.

img

img